?

Log in

= n e r v e c h a n n e l =

Plucking diced carrots of information from the data barf

Name:
Brigand Angel Crew - a grand web clinger
Birthdate:
2 December 1977
Location:
External Services:
  • operon@livejournal.com
>gi|88758587|ref|NM_000794.3| Homo sapiens dopamine receptor D1 (DRD1), mRNA GGCTCGCTGCCTCGCATTGCCACAGGCTCCTGAGAGGTCGCGGGCAGTGCCTGCGGGGAGGCGCGGGGCC CTGCTCTGTAGGGCTGAAGGCCGCCCGAGGTTCGCCAAGGCTCTGGGCTCTCGAAAGGAAGCCAAGAAAA GAAGCTGCCCAGGTGACCAGTCCTGGGAGTGCTCTCTCCCAAGGAAGCTCCGAGCGCCCAGGAGCCCTTA GCCGGGGTCTAGTGCCCTTTGAACAATCTCCAGCTCTTCAAGGAAGTGGGCTGCCGCCGCCTCTCTTGGG ACCTGGCCTGGGATCCTTTCCCCAAACGCACCCCGGCGATTTTTGCGCACCGGGAGCCGAACCCCTGCTG CGCGCAGCTGGCTGGGCTCAGGCGCGCTTCCTCAACGTTTCGGAGCCGCTGCCCCCAGCGAAGTCCACAT TCCAAGCTCCAGGGGCTTTGAGAGAGACGACCCCAAGGCAAGGCGTTTGGAGAGCTGCTGAGGAGCCAGG GGCTTGGAGGAGCGAGAAGACATGTATTTTCAGCTGAGTCTCAGAAGGGGAGAATCTCCTGTCACCACCA GAAAAGCAACAGCCCCGAAATGTGATTGCAACTGACTAGCAGAGCAGAGGCCCAGGAGTCACTGGATTGA TGATTTAGAATATGCTAAAAAGCCAGTGCTTTATTTGGGGAATTCAGGGGCTTTCTGGTGCCCAAGACAG TGACCTGCAGCAAGGGAGTCAGAAGACAGATGTAGAAATCAAGAGTGACCATCCACGGGATTGACTTGGA TTGCCACTCAAGCGGTCCTCTCATGGAATGTTGGTGAGGCCCTCTGCCAGGGAAGCAATCTGGCTGTGCA AAGTGCTGCCTGGTGGGGAGGACTCCTGGAAATCTGACTGACCCCTATTCCCTGCTTGGGAACTTGAGGG GTGTCAGAGCCCCTGATGTGCTTTCTCTTAGGAAGATGAGGACTCTGAACACCTCTGCCATGGACGGGAC TGGGCTGGTGGTGGAGAGGGACTTCTCTGTTCGTATCCTCACTGCCTGTTTCCTGTCGCTGCTCATCCTG TCCACGCTCCTGGGGAACACGCTGGTCTGTGCTGCCGTTATCAGGTTCCGACACCTGCGGTCCAAGGTGA CCAACTTCTTTGTCATCTCCTTGGCTGTGTCAGATCTCTTGGTGGCCGTCCTGGTCATGCCCTGGAAGGC AGTGGCTGAGATTGCTGGCTTCTGGCCCTTTGGGTCCTTCTGTAACATCTGGGTGGCCTTTGACATCATG TGCTCCACTGCATCCATCCTCAACCTCTGTGTGATCAGCGTGGACAGGTATTGGGCTATCTCCAGCCCTT TCCGGTATGAGAGAAAGATGACCCCCAAGGCAGCCTTCATCCTGATCAGTGTGGCATGGACCTTGTCTGT ACTCATCTCCTTCATCCCAGTGCAGCTCAGCTGGCACAAGGCAAAACCCACAAGCCCCTCTGATGGAAAT GCCACTTCCCTGGCTGAGACCATAGACAACTGTGACTCCAGCCTCAGCAGGACATATGCCATCTCATCCT CTGTAATAAGCTTTTACATCCCTGTGGCCATCATGATTGTCACCTACACCAGGATCTACAGGATTGCTCA GAAACAAATACGGCGCATTGCGGCCTTGGAGAGGGCAGCAGTCCACGCCAAGAATTGCCAGACCACCACA GGTAATGGAAAGCCTGTCGAATGTTCTCAACCGGAAAGTTCTTTTAAGATGTCCTTCAAAAGAGAAACTA AAGTCCTGAAGACTCTGTCGGTGATCATGGGTGTGTTTGTGTGCTGTTGGCTACCTTTCTTCATCTTGAA CTGCATTTTGCCCTTCTGTGGGTCTGGGGAGACGCAGCCCTTCTGCATTGATTCCAACACCTTTGACGTG TTTGTGTGGTTTGGGTGGGCTAATTCATCCTTGAACCCCATCATTTATGCCTTTAATGCTGATTTTCGGA AGGCATTTTCAACCCTCTTAGGATGCTACAGACTTTGCCCTGCGACGAATAATGCCATAGAGACGGTGAG TATCAATAACAATGGGGCCGCGATGTTTTCCAGCCATCATGAGCCACGAGGCTCCATCTCCAAGGAGTGC AATCTGGTTTACCTGATCCCACATGCTGTGGGCTCCTCTGAGGACCTGAAAAAGGAGGAGGCAGCTGGCA TCGCCAGACCCTTGGAGAAGCTGTCCCCAGCCCTATCAGTCATATTGGACTATGACACTGACGTCTCTCT GGAGAAGATCCAACCCATCACACAAAACGGTCAGCACCCAACCTGAACTCGCAGATGAATCCTGCCACAC ATGCTCATCCCAAAAGCTAGAGGAGATTGCTCTGGGGCTTGCTATTAAGAAACTAAGGTACGGTGAGACT CTGAGGTGTCAGGAGAGCCCTCTGCTGCTTTCCAACACACAATTAACTCCGTTTCCAAATACATTCCAGT GTATTTTCTGTGTTGTTCATAGTCAATCAAACAGGGACACTACAAACATGGGGAGCCATAAGGGACATGT CTTTGGCTTCAGAATTGTTTTTAGAAATTTATTCTTATCTTAGGATTTACCAAATAGGGCAAAGAATCAA CAGTGAACAGCTTCACTTAAAATCAAATTTTTCTGGGAAGAAAATGAGATGGGTTGAGTTTGCTGTATAC AAACAGGTGCTAACACTGTTCCCAGCAAAGTTTTCAGATTGTAAAGGTAGGTGCATGCCTTCATAAATTA TTTCTAAAACATTAATTGAGGCTTACAGTAGGAGTGAGAAATTTTTTTCCAGAATTGAGAGATGTTTTGT TGATATTGGTTCTATTTATTTATTGTATATATGGATATTTTTAATTTATGATATAATAAATATATATTTA TCATATTTAATAGGATAAATTAATGAGTTTTATCCAAGACCTTACAACCACATTTCTGGCCATTTAACTA GCACTTTATAAGCCAATGAAGCAAACACACAGACTCTGTGAGATTCTAAATGTTCATGTGTAACTTCTAG AAACACAGCAGAAACTGATAGATAAGGGAATAAAGTTGAAATGATTCCTTAAAATTCATGGACACAGATA AATGCAAGGTGAGAATTGACAAATGCTATAAATGCTTTCTTTTTCTGAAAAGATTTTGAAAAATTTAAAA AAGTATAGCTACTACTGTGTTCAAAACGTTTTAAATGACAAATGACTTTCCCAGGGGAATTTGCAGTTCT GTAAATATCTTAAATAAAAGCCAACTTAAGAAGAGCCCAGCATTAAATTTACGATCTTAGGTGGTAATGA AAAGTATATGCTGCTTTGTATTTATGTAAAATAATTGGCCCTCTCCATCTTTTCTCATTTCATGTGTCAG
GTAGTTTTTCTGA

Statistics